Müxtəlif

Rhodiola amabilis

Rhodiola amabilis


Elmi ad

Rhodiola amabilis (H. Ohba) H. Ohba

Sinonimlər

Sedum amabile

Elmi təsnifat

Ailə: Crassulaceae
Cins: Rhodiola

Təsvir

Rhodiola amabilis 10 santimetrə qədər olan, mərkəzi, budaqlı bir quyruqla sərbəst hamak əmələ gətirən sevimli həmişəyaşıl ətli bir ətirdir. Yarpaqları parlaq yaşıl, eliptik, 0,3 düym (7 mm) uzunluğa qədər və rozet şəklində düzülmüşdür. Çiçək sapları 2 santimetrə qədər (5 sm) uzunluqdadır, birinin arasına 0,8 düym (2 sm) qədər bir neçə ağ çiçək daşıyırlar.

Necə böyümək və qulluq etmək

Böyüyəndə Sedum, unutmayın Sedum bitkilərin çox az diqqət və ya qayğıya ehtiyacı var. Bir çox digər bitkilərin inkişaf etdiyi şəraitdə inkişaf edəcəklər, lakin daha az qonaqpərvər ərazilərdə də yaxşı inkişaf edəcəklər. Həyətinizin başqa bir şey yetişdirmək üçün çox günəş və ya çox az su alan hissəsi üçün idealdır. Üçün ümumi bir ad Sedum bir çox bağbanın yalnız daşların daha az qayğıya ehtiyacı olduğunu və daha uzun yaşadığını zarafat etməsi səbəbindən Stonecrop'dur.

Sedum asanlıqla əkilir. Qısa növlər üçün bitkini böyüməsini istədiyiniz yerə qoymaq kifayətdir Sedum bitki orada başladı. Kök yerə və toxuma toxunduğu yerdən kök atacaqlar. Bitkinin orada başlayacağını daha da təmin etmək istəyirsinizsə, bitkinin üstünə çox incə bir torpaq örtüyü əlavə edə bilərsiniz. Boy üçün Sedum növlər, gövdələrdən birini qırıb böyütmək istədiyiniz yerə itələyə bilərsiniz. Kök çox asanlıqla kök salacaq və bir-iki fəsildə yeni bitki qurulacaq ... - Daha çox məlumat: Sedumu necə böyütmək və ona qulluq etmək.

Mənşə

Yerli Nepal və Kəşmir.

Links

Rhodiola cinsinə geri qayıt
SUCCULENTOPEDIA: ətli ətləri cinsinə, ailəsinə, elmi adına, ümumi adına, mənşəyinə və ya kaktuslarına görə araşdırın.

Foto qalereya


İndi abunə olun və ən son xəbərlərimizdən və yeniliklərimizdən xəbərdar olun.





METOD VƏ NƏTİCƏLƏR

Cədvəl 1.

Səkkizdə genetik müxtəliflik Rhodiola 17 mikrosatellite lokusuna əsaslanan populyasiyalar. a

YerR. crenulataR. sacraR. fastigiataR. bupleuroides
RC1 (N = 24)RC2 (N = 24)RS1 (N = 24)RS2 (N = 24)RF1 (N = 24)RF2 (N = 24)RB1 (N = 24)RB2 (N = 24)
AHoHeFAHoHeFAHoHeFAHoHeFAHoHeFAHoHeFAHoHeFAHoHeF
Rs130.8750.518 * −0.68840.4290.480 * 0.10630.0420.119 * 0.6520.0430.043−0.0221400.238 * 1500.361 * 1200.080 * 1
Rs270.750.747−0.00350.7080.699 * −0.01450.2080.2620.20550.2170.4930.559410.576 * −0.73540.6090.472−0.29150.2080.194−0.07160.50.587 * 0.148
Rs380.3040.737 * 0.58790.1110.867 * 0.872300.156 * 130.0830.594 * 0.8630.2080.536 * 0.61180.2080.609 * 0.658110.0420.829 * 0.95100.1670.847 * 0.803
Rs4100.8330.757 * −0.101120.6670.8220.18950.3330.359 * 0.0750.8750.683 * −0.28150.750.635 * −0.18270.9170.752 * −0.219120.2920.661 * 0.55950.2080.497 * 0.581
Rs5200.091 * 11200.5160.1110.753 * 0.85270.5710.709 * 0.19450.30.665 * 0.54930.3330.542 * 0.385300.500 * 1
Rs640.10.685 * 0.85480.10.804 * 0.87630.0430.124 * 0.64980.0590.839 * 0.9340.050.414 * 0.87950.870.681 * −0.276110.1250.891 * 0.86600.813 * 1
Rs730.50.5460.08440.1670.594 * 0.71930.0420.119 * 0.6540.4780.585 * 0.18330.0830.081−0.03240.4170.677 * 0.38520.1250.2490.49830.3330.601 * 0.445
Rs860.0910.645 * 0.85990.3330.734 * 0.546400.358 * 190.250.593 * 0.57870.1670.444 * 0.62480.3040.660 * 0.53980.2270.826 * 0.72550.0830.298 * 0.72
Rs9200.278111200.153 * 1400.691 * 1200.198 * 1400.475 * 1300.480 * 1
Rs1070.3330.4790.30430.0870.084−0.03480.4580.4840.05280.750.753 * 0.00350.8330.633 * −0.31760.7920.678−0.16850.6960.513−0.355110.5830.803 * 0.274
Rs1190.750.8280.09490.5830.849 * 0.31380.5420.804 * 0.32690.9170.661 * −0.38690.4580.857 * 0.46570.1670.578 * 0.71270.2080.658 * 0.68350.0420.296 * 0.859
Rs1230.1670.352 * 0.52640.2080.381 * 0.45330.1250.442 * 0.71740.5420.610.11280.250.505 * 0.50590.0830.566 * 0.85350.2920.4640.37180.2080.679 * 0.693
Rs1340.1250.2890.56890.4290.705 * 0.39290.750.746−0.00640.7920.553 * −0.43290.6670.780 * 0.14690.4550.689 * 0.3440.0870.306 * 0.716120.3910.758 * 0.484
Rs1420.0830.08−0.04370.4170.772 * 0.4650.3330.580 * 0.42540.7080.644−0.140.6670.568−0.17470.50.710.29640.4580.6070.24580.4580.713 * 0.357
Rs1520.0420.041−0.02130.1250.414 * 0.69820.0420.041−0.02120.4580.353−0.29730.7920.588 * −0.34730.0830.258 * 0.67730.1670.2580.35440.130.271 * 0.519
Rs1630.0870.1620.46250.0450.650 * 0.93300.405 * 130.4350.5530.21440.250.659 * 0.6240.1110.539 * 0.79430.050.141 * 0.64630.0950.177 * 0.462
Rs1770.0480.804 * 0.94170.050.786 * 0.93670.0950.680 * 0.86400.525 * 180.250.723 * 0.65480.3640.851 * 0.57370.1110.821 * 0.865120.5450.8930.389
Orta4.8240.2990.4730.3785.8820.2620.5670.4384.3530.1770.3630.5054.8240.3950.5520.2815.1760.4120.5530.235.8820.3630.5780.4375.8240.2010.5170.5556.2350.220.5470.631

Qeyd: A = bir lokus üçün orta allel sayı F = fiksasiya indeksi He = gözlənilən heteroziqot Ho = müşahidə olunan heteroziqot N = nümunə ölçüsü.

Astar cütləri 20-24 əsasdan ibarət təkrar bölgəni özündə cəmləşdirən 66 mikrosatel ardıcıllığı üçün sintez edildi və əvvəlcə hər birindən dörd nümunə istifadə edərək ekranlaşdırıldı Rhodiola növlər. Tavlama temperaturu və reagentlərin nisbətinin dəyişdirilməsi üçün gradient PCR daxil olmaqla PCR optimallaşdırılmasından sonra bu yerlərin 17-si (% 25,8) müstəqil tavlama temperaturu ilə sabit və şəffaf lentlər yaratdı (Cədvəl 2). 17 lokus daha sonra hər populyasiyadan 192 DNT nümunəsi ilə sınaqdan keçirildi Rhodiola növlər (Cədvəl 1). Optimizasiya amplifikasiyaları ∼20 ng genomik DNT, 6.5 μL ikiqat distillə edilmiş su, 1 μL 10 × daxil olmaqla son 10 μL həcmdə həyata keçirilmişdir. Taq reaksiya tamponu, 0,8 μL dNTP, 0,8 μL Mg 2+, 0,25 μL qabaq astarlar, 0,25 μL tərs astarlar və 0,05 μL 0,5 U / μL Taq DNT polimeraz. Aşağıdakı velosiped şərtləri ilə bir Biometra termosikli istifadə edilmişdir: 40 saniyə ərzində 94 ° C-də 5 dəqiqə 35 dövr üçün 94 ° C, 55-57.8 ° C (markerdən asılıdır, Cədvəl 1-ə) 30 saniyə və 40 ° üçün 72 ° C s və 10 dəqiqə ərzində 72 ° C-lik son uzanma pilləsi. PCR məhsulları bir kapilyar elektroforez genotiperi ilə ayrıldı (Majorbio Bio-pharm, Şanxay, Çin). Ayrılmış SSR fraqmentləri GeneMapper versiyası 3.7 (Tətbiqi Biosistemlər) istifadə edilərək araşdırıldı və qiymətləndirildi. Standart populyasiya genetikası metrikləri GenAlEx 6.4 (Peakall and Smouse, 2006) istifadə edilərək hesablanmışdır.

Cədvəl 2.

17 mikrosatellite astarın xüsusiyyətləri inkişaf etdirilmişdir Rhodiola.

YerAstar ardıcıllığı (5′ – 3 ′)Motivi təkrarlayınTa (° C)Allel ölçüsü (bp)GenBanka qoşulma yoxdur.
Rs1F: TTGGGCGGATTGTTCCTGTT(TGA)355181–223 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857096", "term_id": "383511661", "term_text": "JQ857096" >> JQ857096
R: TCCACCCTTCATCTCCTTCA
Rs2F: GCACGATGACAATTTATACGA(TCC)455134–224 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857092", "term_id": "383511657", "term_text": "JQ857092" >> JQ857092
R: GGTTAGGGTTTGGAGGTGAC
Rs3F: TTCCAAATAAGCCAATCCTC(CAA)455183–288 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857095", "term_id": "383511660", "term_text": "JQ857095" >> JQ857095
R: TGTGCAACTGTAACCATCGA
Rs4F: ACCCTTCATCTTGTCCCTCA(CT)855119–150 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857089", "term_id": "383511654", "term_text": "JQ857089" >> JQ857089
R: CACCCTTTTCTGTCCCACTC
Rs5F: GGAGGAAGAACTTCCCATTT(CCT)455163–239 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857082", "term_id": "383511647", "term_text": "JQ857082" >> JQ857082
R: GTGGTGGTGATTGCTTTGAT
Rs6F: GAGTCAGGTGGTGGAGAATG(AGG)455157–262 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857094", "term_id": "383511659", "term_text": "JQ857094" >> JQ857094
R: CAAAAGATTAGAAACTCAAAACG
Rs7F: TTGTGGACTTTGTGGGACTC(GTT)557.8262–277 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857087", "term_id": "383511652", "term_text": "JQ857087" >> JQ857087
R: TGGATAAATTGCTGCCTGAC
Rs8F: CTGACGCTGAAGCAGTTGAT(TGC)557.8131–206 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857085", "term_id": "383511650", "term_text": "JQ857085" >> JQ857085
R: CCCAATGGAGGACCGATGAT
Rs9F: CTTCATCATTTACATCTTGCTC(CCT)655177–204 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857084", "term_id": "383511649", "term_text": "JQ857084" >> JQ857084
R: TTTTGTTACTTGACTGTGGC
Rs10F: TGCGTCAAACGGATCAAACC(CAG)455117–186 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857088", "term_id": "383511653", "term_text": "JQ857088" >> JQ857088
R: TCGCTCAGCCCCTTCTCAAT
Rs11F: GTTGTTGCTTAGGCTGCTGT(GCT)455265–313 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857097", "term_id": "383511662", "term_text": "JQ857097" >> JQ857097
R: AACTTCTATGGAAATGTGGC
Rs12F: AAAAGACAGTATAGCCTCACC(TCA)455112–148 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857091", "term_id": "383511656", "term_text": "JQ857091" >> JQ857091
R: TGTAGACTGATGCTGCTGAT
Rs13F: GAATAAGGTGGCTGGAGGTT(GGA)555156–234 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857089", "term_id": "383511654", "term_text": "JQ857089" >> JQ857089
R: GATGAGGGACAAGATGAAGG
Rs14F: CAGAAGCGGATTCCTCATCA(AGG)455140–200 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857083", "term_id": "383511648", "term_text": "JQ857083" >> JQ857083
R: CGAATCACCCGTAACCCTAA
Rs15F: CCACAGAAGCGAGTCAGGTT(GCATCA)555146–164 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857090", "term_id": "383511655", "term_text": "JQ857090" >> JQ857090
R: GTCCCGGCAAATACAAAAGT
Rs16F: AACAAGGCAGAGTCGAGAAA(GCA)455116–173 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857086", "term_id": "383511651", "term_text": "JQ857086" >> JQ857086
R: CATCTTTGAACCCTAATCCA
Rs17F: ATTCTTCATCTCAGCCGTCC(GA)855126–310 <"type": "entrez-nukleotid", "attrs": <"text": "JQ857093", "term_id": "383511658", "term_text": "JQ857093" >> JQ857093
R: CACAGCCATTAGAGCCAACT

Qeyd: Ta = optimal tavlama temperaturu.

Dördün bütün əhalisi arasında Rhodiola növlər, polimorfik lokus başına düşən allel sayı (A) birdən 12-yə qədər dəyişdi (Cədvəl 1). Polimorfik lokuslar üçün müşahidə olunan orta dəyərlər (Ho) və gözlənilən heterozigot (He) müvafiq olaraq 0.177-dən 0.412-yə və 0.363-dən 0.578-ə qədər dəyişmişdir. Fiksasiya indeksi (F) hər populyasiyada yerlər arasında çox dəyişkəndir (Cədvəl 1) hər növ üçün lokuslar üzrə orta hesabla 0.230 ilə 0.631 arasında dəyişmişdir ki, bu da qarışıq cütləşmə sisteminə uyğundur. Rhodiola. Analiz edilmiş 17 lokus arasında səkkiz-16 lokus ardıcıl Bonferroni testinə əsaslanan Hardy-Weinberg tarazlığından əhəmiyyətli dərəcədə kənarlaşma nümayiş etdirdi (Cədvəl 1) bu, aşkarlanmamış sıfır allellərin mövcudluğunu və ya ideal populyasiyanın tarazlıq şərtlərindən uzaqlaşmasını əks etdirə bilər.


İstixanalı orta ölçülü bağ. Əksər bitki qablarda, bəzi qablar qaldırılmış yataqlarda. Şlamlar pulsuzdur.

Appt və rəsmi açıq qapı günü ilə.

NC, Wansbeck Estate, Stakeford, A189-dan 2 mil, A1-dən 3 mil.

    Qurğuşunlarına İcazə Verilən İtlər WC İşıqlı İçkilər Park Danışıqları

Tərəfdaşlarımız

Bağ bitkilərinin müxtəlifliyini qorumaq

Bizim haqqımızda

Qoruma

Milli Bitki Kolleksiyaları

Necə kömək edə bilərsən?

Tədbirlər

Yerli Qruplar

Bitki irsi, 12 ev təsərrüfatı, Loseley Park, Guildford, Surrey GU3 1HS | Tel: 01483 447540

© Bitki İrsi 2021. Reg. xeyriyyə № 1004009 / SCO41785. Reg şirkəti 2222953

Bu veb saytımızda ən yaxşı təcrübəni əldə etməyinizi təmin etmək üçün çerezlərdən istifadə edir. Daha çox oxu